DHM1 is a cya-deleted E. coli, slow growing, temperature sensitive mutant strain that is used for the B2H screening. For the immunoprecipitations, Y. pseudotuberculosis ATCC® 6902™ was used. YPT YPIII pIB102 (Bölin & Wolf-Watz, 1984) (WT) and YPIII pIB100Δpnp (Rosenzweig et al., 2005) were used for the cold growth and H2O2 plate-based

assays. The arabinose-inducible promoter containing pBAD24 (Guzman et al., 1995) plasmid was used as a cloning vector into which a carboxy-truncated RNase E (encoding only the first 465 amino acid residues in the amino terminus) was cloned (Yang et al., 2008). For all inductions, 0.02% arbinose was used unless otherwise noted. Ampicillin working concentrations were 100 μg mL−1. RNaseE CTD: Forward: tcaggattcctccagcattggctacc Reverse: tcagaattcttactcaacagattgc Regorafenib PNPase: Forward: tcaggatcctttgctgactccgattattcg Reverse: tcagaattcttactctgctgctgcttc

RhlB helicase: Forward: tcaggatcctatgagcaaaacacacttg Reverse: Vemurafenib clinical trial tcagaattctcagcctggtcgcttacgg Enolase: Forward: tcaggatcctatgtccaaaattgttaaag Reverse: tcagaattcttactggcctttaacttc RNE CTD: Forward: tcaggatcctctggcgacgttctctctg Reverse: tcagaattcctattcaaccgattgtg RhlB helicase: Forward: tcaggatcctttgaccgaacagaag Reverse: tcagaattctcagctcggtcgcttac RNase E CTD was cloned into the plasmid pKT25, while full-length enolase, PNPase, and RhlB were cloned into plasmid pUT18C. PCR products were generated using a 2X PCR master mix (New England Biolabs), and all cloning was performed using BamH1 and EcoR1 high-fidelity enzymes (New England Biolabs). All constructs were sequenced to confirm that they were correct. After DHM1 were harvested at OD600 nm of 0.5–0.6, pellets were washed twice in 1.0 mL of ice-cold water, washed once in ice-cold 10% polyethylene glycol (PEG), and resuspended in ~ 750 μL 10% PEG. To introduce plasmids, the cells were electroporated at 1700 V (BioRad Inc.). Following a 1-h recovery at 30 °C with agitation,

transformations were plated on LB agar plates containing Liothyronine Sodium 40 μg mL−1 X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranosid), IPTG (0.5 mM), 100 μg mL−1 of ampicillin, and 50 μg mL−1 of kanamycin. Plates were placed at 30 °C, and colonies were observed between 48–72 h later (Euromedex Inc.). YPT was grown in 100 mL of LB medium to OD620 nm of 0.7. Cells were harvested by centrifugation at 5000 g for 15 min at 4 °C. Pellets were then resuspended in 5 mL 1X IP Buffer as part of a commercially available Protein G immunoprecipiation kit (Sigam Aldrich IP50). Complete EDTA-free protease inhibitor cocktail (Roche) (one tablet per 5 mL of solution) was added to the resuspended cells. Cells were lysed via sonication, and 600 μL of sonicate/lysate was used for downstream IP reaction (Sigma IP kit protcol).

The information on the differential

distribution of these DNA sequences in the 15 serotypes of A. pleuropneumoniae may contribute to future research on the pathogenic mechanisms of different serotypes, typing-based diagnosis methods, and multivalent vaccines. Porcine contagious pleuropneumonia, which is caused by Actinobacillus pleuropneumoniae, is an extremely contagious and often fatal respiratory disease (Macinnes & Rosendal, 1988). This disease occurs in the countries that have a swine industry, and it is responsible for enormous economic losses to the swine industry. To date, 15 serotypes of A. pleuropneumoniae have been described (Blackall et al., 2002). These serotypes show significant differences

in pathogenicity and immunogenicity (Cruijsen et al., 1995; Jacobsen et al., 1996). Therefore, vaccines raised INCB018424 order against a specific serotype do not confer protection from infection by other serotypes (Ramjeet et al., 2008). Owing to the limited information on the genetic differences among the serotypes, studies on the immunity mechanisms of different serotypes, typing-based diagnosis, and multivalent genetically engineered vaccines have been significantly hampered. Therefore, the genomic differences among the principal serotypes should be identified and suitably exploited. Actinobacillus pleuropneumoniae serotypes 1 and 3 show the most BMS907351 significant variation in Dichloromethane dehalogenase pathogenicity (Jacobsen et al., 1996). Serotype 1 is highly virulent, and infection of this serotype is associated with epidemic outbreak, high mortality, and serious lung lesions. However, serotype 3 is considered to be less virulent (Bosse et al., 2002).

Moreover, there are significant differences between the immunogenicities of the two serotypes, and the available vaccines for the two serotypes do not provide cross-protection (Cruijsen et al., 1995; Ramjeet et al., 2008). In this study, we identified the genomic differences between A. pleuropneumoniae serotypes 1 and 3 by performing representational difference analysis (RDA). This technique has been widely used to analyze genetic differences in bacteria (Lisitsyn & Wigler, 1993; Tinsley & Nassif, 1996), especially in the light of the limited availability of complete genome-sequence data and microarrays (Barcellos et al., 2009; Sack & Baltes, 2009). We identified the distribution of all the identified differential DNA sequences between the 15 serotypes of A. pleuropneumoniae. Actinobacillus pleuropneumoniae strains used for this study are listed in Table 1.

More frequent monitoring of renal function (every 4 weeks during the first year, and every 3 months thereafter)

is recommended in the SPC for tenofovir. Referral to a renal physician should be considered for patients suspected to have a glomerulonephritis (haematuria and/or uPCR >100 mg/mmol) and those with a severe or progressive decline in renal function, advanced renal failure (eGFR <30 mL/min) or severe hypertension associated with renal injury (uPCR >100 mg/mmol or eGFR <60 mL/min) (IV). HIV infection is associated with increased levels of triglycerides and decreased levels of high-density lipoprotein (HDL) cholesterol. ART may affect lipid levels and independently increase cardiovascular risk [22-26]. CVD is an increasingly important cause of mortality and morbidity in patients with HIV infection in the UK [27], emphasizing the importance selleck screening library of assessing lipid profiles and managing dyslipidaemia Pexidartinib research buy (as part of the overall cardiovascular risk) in those with HIV infection. Lipid levels should be assessed in the context of overall CVD risk. CVD risk assessments generally incorporate

age, gender, smoking, blood pressure, diabetes, the ratio of total:HDL cholesterol, and the presence or absence of left ventricular hypertrophy on electrocardiogram [28]. The Framingham CVD risk calculator works reasonably well in HIV-positive populations, although it is worth noting that it was not developed for use in non-White groups. Other algorithms may be better suited to these populations. A CVD risk calculator has been developed for use in HIV-positive populations (www.chip.dk/TOOLS) [29], although it should be noted that this provides 5-year risk estimates rather than the usual 10-year estimates. Epothilone B (EPO906, Patupilone) This calculator includes abacavir exposure as a CVD risk factor; the data regarding abacavir as a CVD risk factor, however, remain inconsistent. Alternatively,

the QRISK calculator (www.qrisk.org) or the QIntervention tool (http://qintervention.org), which also provide an estimate of the risk of developing type II diabetes, can be used. CVD risk can be reduced by smoking cessation, blood-pressure management (including nonpharmacological measures) and lipid-lowering interventions. Smoking cessation should be repeatedly encouraged. Weight reduction, diet and exercise may improve blood pressure and HDL-cholesterol levels. Decisions on lipid-lowering therapy should be based on overall cardiovascular risk rather than lipid levels in isolation. D-dimer levels, highly sensitive CRP, and IL-6 have recently been correlated with cardiovascular events and death [30]. While these biomarkers may become useful in identifying high-risk patients and contribute to the debate regarding when to start ART, they remain research tools and are not recommended for routine evaluation at present (IV).

The Km for the substrate 1-H2NA remained unaltered

in the presence of NADPH or NADH (Table 5). The enzyme showed similar Km for NADPH and NADH (Table 5). The saturation plot for FAD was hyperbolic and Km was determined to be 4.7 μM (Table 5). Alcaligenes sp. strain PPH degrades phenanthrene, hydroxybenzoates (o-, m- and p-) and o-phthalate (Deveryshetty et al., 2007). Based on metabolic analysis, the proposed pathway for phenanthrene degradation is: phenanthrene 1-H2NA 1,2-DHN salicylaldehyde salicylic acid catechol. The steps involved in the metabolism of 1-H2NA to salicylic acid are similar to that involved in naphthalene degradation and hence referred to as the ‘naphthalene Selleckchem Ipatasertib route’. The generated catechol enters the central carbon cycle via the meta ring-cleavage pathway. Organisms capable of degrading phenanthrene via the ‘naphthalene route’ have the ability to degrade naphthalene (Davies & Evans, 1964; Evans et al., 1965; Menn et al., 1993; Sanseverino et al., 1993; Kiyohara et al., 1994; Takizawa et al., 1994; Yang et al., 1994). Interestingly, strain PPH failed to metabolize naphthalene as the carbon source; this could be due to lack of naphthalene dioxygenase or the presence of highly specific phenanthrene dioxygenase in this strain. Compared to salicylate,

phenanthrene-grown cells showed higher specific activity of 1-hydroxy-2-naphthoic acid hydroxylase (Table 2). As observed for several aromatic degradative pathways (Grund et al., 1990; Gescher et al., 2002; Phale et al., 2007; Swetha et al., MK-8669 2007; Deveryshetty & Phale, 2009), enzymes of phenanthrene

degradation in strain PPH were also found to be inducible in nature. The upper-pathway enzymes of naphthalene degradation (naphthalene to salicylic acid) have been proposed to be involved in the conversion of phenanthrene to 1-H2NA and anthracene to 2-hydroxy-1-naphthoic acid (Menn et al., 1993). Further, 1-H2NA was metabolized to 1,2-DHN by salicylate-1-hydroxylase and reported to have broad substrate specificity (Balashova et al., 2001). In Alcaligenes sp. strain PPH, enzyme induction pattern and heat stability studies suggested the existence of two different enzymes, 1-hydroxy-2-naphthoic acid hydroxylase Ribose-5-phosphate isomerase and salicylate-1-hydroxylase, responsible for the conversion of 1-H2NA to 1,2-DHN and salicylic acid to catechol, respectively. The enzyme responsible for the hydroxylation of 1-H2NA has not been reported so far. This is the first study reporting the existence of 1-hydroxy-2-naphthoic acid hydroxylase. The property of heat stability helped to resolve 1-hydroxy-2-naphthoic acid hydroxylase from salicylate hydroxylase and was exploited to partially purify the protein (Table 3). The enzyme was yellow in color and showed characteristic flavoprotein absorption spectrum (Fig. 2), as observed for several other hydroxylases (Yamamoto et al., 1965; Hesp & Calvin, 1969; White-Stevens & Kamin, 1972).

This differs from previous approaches to VFR travelers based on indirect factors for health risk (eg, administrative category of migrant, country of birth, destination), factors that may not be directly relevant to the determination

of adverse health or disease outcomes. The increased complexity in managing risk during assessments of travelers and travel-associated outcomes challenge the adequacy of the traditional VFR traveler definition. Issues contributing to these complex challenges are the rapid urbanization and socioeconomic development occurring globally, urbanization and focal socioeconomic selleck inhibitor development occurring in both economically advanced and developing countries, and the increased accessibility, availability, and affordability of high-speed BGJ398 mouse international travel. A challenge in the existing approach to the definition of the VFR traveler has been the focus on ethnicity and the traveler’s birthplace. Although both may contribute to the potential for adverse health outcomes during travel, our knowledge of the complexity of risk assessment and health determination has improved beyond these two constructs. The concept

of an ethnically identifiable and distinct immigrant individual who returns to visit family or friends in an economically developing country becomes more difficult to identify and less precise Endonuclease in risk applications. The perception of risk is also a significant determinant of how travelers approach personal protection and safety. This is a very challenging area of travel medicine practice

as previous experience, the media, international agencies, and other factors play a significant role in the belief that one may be at risk or in how to manage that risk.7–9 As the world evolves under the processes of globalization and travel between regions becomes more varied and diffuse, a different approach to assessing health risks during travel can now be applied. The new definitional framework for identifying and defining the VFR traveler requires that the intended purpose of travel is to visit friends or relatives; and there is an epidemiological gradient of health risk between the two locations based on an assessment of the determinants of health, including traveler behavior, socioeconomic status, genetic-biological attributes, and environmental exposures.

For RNA isolations, NT-26 was grown heterotrophically with and without arsenite until the mid log, late log and stationary phases. Arsenite oxidation was measured as reported previously (Santini et al., 2007). DNA sequence upstream of the arsenite oxidase gene aroB was obtained by a primer walking method using a previously constructed genomic DNA library (Santini & vanden Hoven, 2004). To identify putative genes, the sequence results obtained

were submitted to the database search engines smart (Schultz et al., 1998), pfam (Bateman et al., 2002) and tmhmm (Krogh et al., 2001). Sequence alignments were performed using either blastp (Camacho et al., 2008) or clustalw (Larkin et al., 2007). The aroR and aroS sequences have been deposited in GenBank under the accession number AY345225. AroS and AroR genes were PCR amplified using genomic DNA (Santini & vanden Hoven, 2004) as a template. The digested amplified products were ligated into NcoI- and HindIII-digested this website pEMBL His-GST vector. Site-directed mutagenesis was performed using the QuikChangeTM Site-Directed GSK126 mouse Mutagenesis Kit (Stratagene, La Jolla, CA) protocol. All genes were sequenced (Eurofins MWG Operon) to verify cloning and to ensure that the correct mutations had been introduced. The constructs allowed for the overexpression of genes with an N-terminal

polyhistidine affinity tag and a tobacco etch virus (TEV) protease cleavage site to allow for removal of the affinity tag. Mutagenesis of aroR and aroS was performed by targeted gene

disruption as described previously for aroA (Santini & vanden Hoven, 2004) and cytC (Santini et al., 2007). Portions of the aroR and aroS genes were amplified using the following primers: AroRFor (binds Ibrutinib to nucleotides 31–50) 5′-GCGGATCCCTCGAAGATGATCCGATCAT-3′ (the recognition sequence for EcoR1 is underlined) and AroRRev (binds to nucleotides 709–728) 5′-GCGAATTCGCTGCATGACGCCAATCTCG-3′ (the recognition sequence for BamH1 is underlined); AroSFor (binds to nucleotides 222–242) 5′-GCGGATCCCTATGATCTGCTCGACCGTAC-3′ (the recognition sequence for EcoR1 is underlined) and AroSRev (binds to nucleotides 1082–1102) 5′-GCGAATTCTGCTCATGCACGTCAATGTCT-3′ (the recognition sequence for BamH1 is underlined). The PCR products were digested with EcoR1 and BamH1 and cloned into the suicide plasmid pJP5603 (KmR) and transferred into NT-26 by conjugation (Santini & vanden Hoven, 2004; Santini et al., 2007). One aroR and one aroS mutant were chosen for further study. Mutants were tested for their abilities to grow chemolithoautotrophically and heterotrophically. As no growth was detected with either mutant when grown chemolithoautotrophically with 5 mM arsenite, growth experiments were only conducted under heterotrophic conditions. Growth experiments were conducted with two replicates on two separate occasions in batch cultures in the MSM with 0.04% yeast extract with and without 5 mM arsenite.

0001). IGART scores improved after the switch to etoricoxib (P < 0.05). Results from TSQM demonstrated that patient perceptions of effectiveness, convenience and overall satisfaction increased. Etoricoxib was generally well tolerated in most patients. The most commonly reported adverse event was edema (4.2%). Conclusions:  In OA patients experiencing inadequate relief from a wide variety of analgesics, pain, function, quality of life, and treatment satisfaction significantly

improved when switched to HDAC inhibitor etoricoxib. “
“Septic arthritis is a common and serious problem. Early detection and prompt treatment improve outcomes. To evaluate serum procalcitonin for diagnosis of acute bacterial septic arthritis and to compare its diagnostic utility with synovial white blood cells (WBC), erythrocyte sedimentation rate (ESR) and high-sensitivity C-reactive protein (hs-CRP). A prospective cross-sectional study was performed in 78 Thai patients with acute arthritis. Patients with concomitant infections were excluded. Twenty-eight patients were diagnosed with acute bacterial septic arthritis and 50 patients were diagnosed with acute inflammatory arthritis. Blood samples were collected for complete blood count, ESR, hs-CRP, procalcitonin

and hemoculture. Synovial fluid was sent for cell count, Gram stain, crystals identification and culture. The diagnostic accuracy by area under receiver operating characteristic

(ROC) curve was calculated. find more Resminostat Patients with acute bacterial septic arthritis had higher procalcitonin levels than in acute inflammatory arthritis (mean ± SD = 1.48 ± 2.30 vs. 0.44 ± 0.92 ng/mL, P = 0.032). The cut-off level of procalcitonin was 0.5 ng/mL for which sensitivity, specificity and accuracy for diagnosis of bacterial septic arthritis were 59.3%, 86% and 75.3%, respectively. The ROC curve analysis showed that procalcitonin had a good diagnostic performance (area under the curve = 0.78, 95% CI 0.69–0.89). The area under the curve of hs-CRP and synovial fluid WBC were 0.67 (95% CI 0.55–0.79) and 0.821 (95% CI 0.720–0.923), respectively. Combining procalcitonin with other markers did not provide better sensitivity or specificity than procalcitonin alone. Serum procalcitonin has a potential role in diagnosing acute bacterial septic arthritis, especially if arthrocenthesis cannot be performed. “
“Immunoglobulin G4 (IgG4)-related sclerosing disease is a newly recognized clinicopathological entity characterized by lymphoplasmacytic infiltration and varying degrees of fibrosis in various organs, with abundant IgG4-positive plasma cells in tissues. Patients usually exhibit multisystem involvement and often respond well to steroid and immunosuppressive therapy. However, this disease has been rarely reported in a Chinese population.

As a consequence, it was proposed that treatment and follow-up in the monotherapy arm should be continued, for those patients with a completely satisfactory virological response (<50 copies/mL). This amendment was approved by the Ethics Committees, and all patients on LPV/r

monotherapy who remained on follow-up in the study signed an additional informed consent stating that they were informed of the cessation of the follow-up of the Rucaparib order triple-drug arm. The results presented herein focus on a noncomparative outcome description of patients initially randomized to receive LPV/r monotherapy, and who continued with LPV/r post week 48. A total of 83 subjects were initially randomized to the monotherapy arm of the study. Overall, 48 of the 83 patients initially randomized to LPV/r monotherapy were still

on LPV/r monotherapy at week 96 (Fig. 1). At week 96, by intent-to-treat (ITT) analysis, 39 of 83 patients (47%) had a plasma HIV RNA <50 copies/mL. Considering the 56 patients on LPV/r monotherapy with buy Forskolin HIV RNA <50 copies/mL at week 48, 46 of these patients remained on LPV/r monotherapy at week 96 and 10 patients discontinued before week 96. Among these 56 patients, virological response was sustained for 38 patients (68%), five (9%) had HIV RNA between 50 and 400 copies/mL, and three (5%) had HIV RNA >400 copies/mL (Table 1). Considering the 11 patients on LPV monotherapy with HIV RNA >50 copies/mL at week 48, one patient had a sustained virological response on LPV monotherapy, five patients discontinued the treatment, four patients had treatment alterations and one patient had a missing HIV RNA value at week 96 (Table 1 and Fig. 1). The median increase (interquartile range) in CD4 cell count from baseline was 165 (100–248) cells/μL (n=47 patients). In addition, the allocated treatment was changed 4-Aminobutyrate aminotransferase for seven patients (8%): six patients underwent treatment intensification with zidovudine/lamivudine (ZDV/3TC) (3 before

week 48, and 3 after week 48) and the remaining patient discontinued treatment after week 48 (Fig. 1). During the entire 96-week treatment period, PI-associated major resistance mutations were evident in five of 83 patients (6%): mutations M46I and L63P in one patient at week 40 (concomitant HIV RNA 2.9 log10 copies/mL), L76V in one patient at week 44 (concomitant HIV RNA 2.8 log10 copies/mL), I13V, M46I and L76V in one patient at week 62 (concomitant HIV RNA 2.6 log10 copies/mL), L10F and V82A in one patient at week 76 (concomitant HIV RNA 3.1 log10 copies/mL), and L76V in one patient at week 90 (concomitant HIV RNA 2.5 log10 copies/mL). These mutations did not result in any significant phenotypic or genotypic resistance to LPV/r [15].

The diagnostic agreement Alectinib supplier between the examiner and the gold standard was satisfactory for all the diagnostic criteria. The percentage diagnostic agreement exceeded 95%. Clinical examination took place in the classroom with

the child sitting on a stool, under artificial lighting. A mouth mirror, a probe and cotton wads to remove excess plaque were used. All data were collected in a record chart designed for this study in which following the criteria established by EAPD for epidemiological studies[11] every child was coded M (affected by MIH) when at least one permanent first molar presented hypomineralization, whether or not any incisor was also affected. Every Selleckchem BAY 73-4506 surface of the incisors and permanent first molar were examined, and the relevant diagnostic code

(Table 1) was recorded on the odontogram of the chart. Only defects easily distinguishable larger than 2 mm were recorded. The type of treatment required on the basis of the WHO guidelines was also recorded and accordingly, as follows: Checkups: if no treatment was needed or only preventive care to arrest caries and/or seal fissures was required. Non-urgent treatment: when the need was for one or more superficial fillings and treatment for aesthetic reasons. Urgent treatment: when a crown, pulp care and restoration or extraction was needed. To collect information on the medical history of the mother during the pregnancy and childbirth and on the child’s early years, a questionnaire was sent by post and each child handed it in at school, together with the signed informed consent prior to the oral examination. As a part of a larger study, the caries indices for the permanent teeth (DMFT and DMFS) were also measured, using the WHO criteria[24]. To measure the reproducibility of the diagnoses, including those of MIH, 51 examinations were repeated 1 month later. The resulting

weighted Kappa was 0.86, indicating a very high level of agreement. SPSS 18.0® (SPSS Inc., Chicago, IL, USA) was used for statistical analysis. Means were compared using Student’s t-test and anova, and the chi-squared test was used for proportion comparison. The significance level Carnitine palmitoyltransferase II was 0.05. The final sample size was 840 children, comprising 51% boys and 49% girls. With a total of 840 children examined and a confidence level of 95% (α = 0.05) for the MIH prevalence found in this reference population of approximately 45,000 people, the level of precision of this study was 0.024. A total of 9668 teeth were examined and 412 teeth could not be examined because of incomplete eruption (1.01% were first permanent molars and 5.6% were incisors). Of the anomalies encountered in dental structures, MIH was the most prevalent, 21.8% (95% CI 19.1–24.

Within these groups, the NNH was plotted against age and systolic blood pressure (sBP), and for the latter a value of 120 mmHg, which represents the median observed in the D:A:D study, was chosen [27,28]. The applied

CP-673451 solubility dmso Framingham equation was developed for a population with no prior coronary heart disease (CHD) and thus does not reflect the risk of developing an MI in that patient group. According to the NCEP/ATP III guidelines, a history of CHD is considered to confer a 10-year CHD risk in excess of 20% [26], roughly corresponding to a 10-year risk of MI of 10% and a 5-year risk of MI of 5%. To summarize the uncertainty associated with NNH, the 95% confidence interval (CI) for the relative rate of MI (1.47, 2.45) reported by Sabin et al. [4] is incorporated in the calculations, as described below. All NNH values represent GSK-3 inhibitor review the number of patients

who need to be treated with abacavir for 5 years to observe MI in one additional patient as a consequence of this treatment. Using the 10 and 20% cut-offs proposed in the NCEP/ATP III guidelines for assessing 10-year CHD risk [26] we defined low-, medium- and high-risk groups with absolute risks of MI of <5, 5–10 and >10% over 5 years, respectively. Therefore, in patients who are not on abacavir this risk will reflect the underlying risk of MI alone, while in patients on abacavir the absolute risk will consist of both the underlying risk of MI and the additional risk attributed to use of abacavir. The

relationship between NNH and underlying risk of MI is reciprocal (Fig. 1; dashed line), whereas the relationship between ARI and underlying risk of MI is linear (Fig. 1; continuous line). The NNH decreases quickly from 185 to 5 as the underlying risk of MI increases from 0.6 to >20%. If the underlying risk of MI is 5%, the ARI will be 4.5% (i.e. a 90% increase) and the NNH with abacavir will be 22. An ARI of 4.5% implies that using the drug over the next 5 years will increase this patient’s risk of having an MI from 5 to 9.5%. An NNH of 22 implies that if 22 patients with an estimated underlying risk of MI of 5% use abacavir over this same 5-year period, one additional patient may be expected Thiamine-diphosphate kinase to develop an MI which would not have occurred had this group of patients not used abacavir. As the relationship is reciprocal, the same absolute change in the underlying risk of MI results in a small change in NNH for patients with a high MI risk and a large change for patients with a small underlying risk of MI. For example, a 5% decrease in the underlying risk of MI for an underlying risk of 15% reflects NNH changing from 7 to 11, while the same decrease for an underlying risk of 6% changes the NNH value from 18 to 111. Relating ARI to the underlying risk of MI is not capturing this relationship. In order to determine the level of uncertainty we estimated the 95% CI for all NNH values presented in Table 1.