Beads were washed with PBS, 20 mL of 2× sample buffer was added per sample, and an immunoblot with α-KLF6 (sc7158) was performed. RNA was collected, reverse transcribed, and amplified as described.23 The following primers were selleck chemicals used: mCyclophillin F/R (CAGACGCCACTGTCGCTTT/TGTCTTTGGAACTTTGTCTGCAA), hKLF6 F/R (CGGACGCACACAGGAGAAAA/CGGTGTGCTTT CGGAAGTG), SV1 F/R (CCTCGCCAGGGAAGG AGAA/CGGTGTGCTTTCGGAAGTG). Cycloheximide (10 mg/mL) was added 24 hours after cotransfection and protein collected at 0, 15, 30, and 60 minutes. MG132 (Sigma C2211) was added

(5 mM) 4 hours prior to adding cycloheximide. Cotransfection of p21 luciferase and Renilla plasmids was performed as described.5 Cells were washed with PBS twice and 30 mL of Lysis Buffer (Promega passive Lysis Buffer 5x, #E194A) was added per well. Data are expressed as mean ± standard error of the mean (SEM) or standard deviation (SD). Student’s t test, analysis of variance (ANOVA), Mann-Whitney, and chi-square (3-way contingency table) were calculated to compare experimental groups. Differences were considered statistically GW-572016 supplier significant if P

< 0.05. Analyses were conducted using R statistical package and SPSS software (v. 14) for the human data,2 and GraphPad prism for the remaining data. The SV1/KLF6 mRNA splicing ratio is increased in 18% of HBV-associated10 and 0%-76% of HCV-positive10, 16 HCCs. Here we analyzed the SV1/KLF6 mRNA splicing ratio in liver tissues from 149 HCV-positive patients with progressive stages of HCV-associated liver disease.2 The splicing ratio was significantly increased in HCC samples pentoxifylline compared to nontumoral tissues, including normal liver (P = 0.03), cirrhotic liver (P = 0.01), or dysplastic nodules (P < 0.001). In addition, the ratio linearly increased with progressive stages of HCC (P < 0.001) (Fig.

1A). This finding raised the possibility that increased KLF6 splicing might contribute to tumor behavior or clinical outcomes. We examined whether the SV1/KLF6 mRNA ratio was correlated with features of more advanced disease. Accordingly, we correlated SV1/KLF6 mRNA ratio with clinical and pathological variables in a subset of 55 HCCs from whom these data were available. Increased SV1/KLF6 ratio was significantly associated with larger tumors (P = 0.04) and vascular invasion (P = 0.01) (Fig. 1B). The KLF6 splicing ratio was not correlated with survival, however (data not shown). These findings are consistent with earlier reports in prostate, lung,21 ovarian,20 and pancreatic19 cancers, where SV1 has been correlated with more aggressive disease. To clarify the role of an increased KLF6 splicing ratio in hepatocarcinogenesis, we generated mice with different SV1/KLF6 ratios by first crossing double floxed Klf6 mice (Klf6fl(+/+)) with albumin-Cre transgenic animals (AlbCre).