DHM1 is a cya-deleted E. coli, slow growing, temperature sensitive mutant strain that is used for the B2H screening. For the immunoprecipitations, Y. pseudotuberculosis ATCC® 6902™ was used. YPT YPIII pIB102 (Bölin & Wolf-Watz, 1984) (WT) and YPIII pIB100Δpnp (Rosenzweig et al., 2005) were used for the cold growth and H2O2 plate-based

assays. The arabinose-inducible promoter containing pBAD24 (Guzman et al., 1995) plasmid was used as a cloning vector into which a carboxy-truncated RNase E (encoding only the first 465 amino acid residues in the amino terminus) was cloned (Yang et al., 2008). For all inductions, 0.02% arbinose was used unless otherwise noted. Ampicillin working concentrations were 100 μg mL−1. RNaseE CTD: Forward: tcaggattcctccagcattggctacc Reverse: tcagaattcttactcaacagattgc Regorafenib PNPase: Forward: tcaggatcctttgctgactccgattattcg Reverse: tcagaattcttactctgctgctgcttc

RhlB helicase: Forward: tcaggatcctatgagcaaaacacacttg Reverse: Vemurafenib clinical trial tcagaattctcagcctggtcgcttacgg Enolase: Forward: tcaggatcctatgtccaaaattgttaaag Reverse: tcagaattcttactggcctttaacttc RNE CTD: Forward: tcaggatcctctggcgacgttctctctg Reverse: tcagaattcctattcaaccgattgtg RhlB helicase: Forward: tcaggatcctttgaccgaacagaag Reverse: tcagaattctcagctcggtcgcttac RNase E CTD was cloned into the plasmid pKT25, while full-length enolase, PNPase, and RhlB were cloned into plasmid pUT18C. PCR products were generated using a 2X PCR master mix (New England Biolabs), and all cloning was performed using BamH1 and EcoR1 high-fidelity enzymes (New England Biolabs). All constructs were sequenced to confirm that they were correct. After DHM1 were harvested at OD600 nm of 0.5–0.6, pellets were washed twice in 1.0 mL of ice-cold water, washed once in ice-cold 10% polyethylene glycol (PEG), and resuspended in ~ 750 μL 10% PEG. To introduce plasmids, the cells were electroporated at 1700 V (BioRad Inc.). Following a 1-h recovery at 30 °C with agitation,

transformations were plated on LB agar plates containing Liothyronine Sodium 40 μg mL−1 X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranosid), IPTG (0.5 mM), 100 μg mL−1 of ampicillin, and 50 μg mL−1 of kanamycin. Plates were placed at 30 °C, and colonies were observed between 48–72 h later (Euromedex Inc.). YPT was grown in 100 mL of LB medium to OD620 nm of 0.7. Cells were harvested by centrifugation at 5000 g for 15 min at 4 °C. Pellets were then resuspended in 5 mL 1X IP Buffer as part of a commercially available Protein G immunoprecipiation kit (Sigam Aldrich IP50). Complete EDTA-free protease inhibitor cocktail (Roche) (one tablet per 5 mL of solution) was added to the resuspended cells. Cells were lysed via sonication, and 600 μL of sonicate/lysate was used for downstream IP reaction (Sigma IP kit protcol).